graph-pad prism 3.0 software Search Results


86
Dow Corning sylgardtm 184 silicone elastomer kit pdms dow corning sylgard 184 bottomless microplate
Sylgardtm 184 Silicone Elastomer Kit Pdms Dow Corning Sylgard 184 Bottomless Microplate, supplied by Dow Corning, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/184+sylgard/pm40730156-161-174-180
Average 86 stars, based on 1 article reviews
sylgardtm 184 silicone elastomer kit pdms dow corning sylgard 184 bottomless microplate - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
10X Genomics krec assay reverse 50 ctccaataagtcaccctttccttgt 30
Krec Assay Reverse 50 Ctccaataagtcaccctttccttgt 30, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/30+50+assay+ctccaataagtcaccctttccttgt+krec+reverse/pm34626548-177-176-202
Average 86 stars, based on 1 article reviews
krec assay reverse 50 ctccaataagtcaccctttccttgt 30 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Eurofins reverse eurofins 50tgggagtagacaaggtacaaccc 30 tnf alpha
Reverse Eurofins 50tgggagtagacaaggtacaaccc 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/031168+30+50cagataagctggagtcacagaaggagtgg+6+alpha+eurofins+il+nm+probe+tnf/pm30995475-232-109-110
Average 86 stars, based on 1 article reviews
reverse eurofins 50tgggagtagacaaggtacaaccc 30 tnf alpha - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Matrix Science algorithms graphpad prism 7 graphpad
Algorithms Graphpad Prism 7 Graphpad, supplied by Matrix Science, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/mascot+software/pmc07336508-484-3-24
Average 86 stars, based on 1 article reviews
algorithms graphpad prism 7 graphpad - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

99
Bio-Rad algorithms image lab touch 2 1 bio rad n a imagej version 2 0 0 nih
Algorithms Image Lab Touch 2 1 Bio Rad N A Imagej Version 2 0 0 Nih, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/Image+Lab+Software/pm32589908-610-56-61
Average 99 stars, based on 1 article reviews
algorithms image lab touch 2 1 bio rad n a imagej version 2 0 0 nih - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

97
ATCC 10378016 fetal bovine serum sigma aldrich f6178 experimental models
10378016 Fetal Bovine Serum Sigma Aldrich F6178 Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/Fetal+Bovine+Serum/pm41411132-569-158-174
Average 97 stars, based on 1 article reviews
10378016 fetal bovine serum sigma aldrich f6178 experimental models - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

90
Microsynth ag sirna_l3mbt1_7
Sirna L3mbt1 7, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/sirna+l3mbt1+5/pmc08170441__mmc3-253-161-161
Average 90 stars, based on 1 article reviews
sirna_l3mbt1_7 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

97
ATCC yale h1975 atcc crl 5908 skbr3 atcc htb 30 gtl16 f maina
Key Resources Table
Yale H1975 Atcc Crl 5908 Skbr3 Atcc Htb 30 Gtl16 F Maina, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/NCI-H1975/pmc05831399-269-201-203
Average 97 stars, based on 1 article reviews
yale h1975 atcc crl 5908 skbr3 atcc htb 30 gtl16 f maina - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
STATA Corporation excel version 3 20
Key Resources Table
Excel Version 3 20, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/STATA+3%2E0/pmc07926015-158-7-11
Average 99 stars, based on 1 article reviews
excel version 3 20 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Becton Dickinson diva software 6.3.30.000
Key Resources Table
Diva Software 6.3.30.000, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/diva+software+6+3+30+000/pmc09417345-193-19-8
Average 90 stars, based on 1 article reviews
diva software 6.3.30.000 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
10X Genomics single cell 30 reagent kits v2 10xgenomics
Key Resources Table
Single Cell 30 Reagent Kits V2 10xgenomics, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/cellranger/pm37382276-348-91-97
Average 86 stars, based on 1 article reviews
single cell 30 reagent kits v2 10xgenomics - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

91
Addgene inc pll3 7m clover geminin 1 110 ires mko2 cdt 30 120
Key Resources Table
Pll3 7m Clover Geminin 1 110 Ires Mko2 Cdt 30 120, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph-pad+prism+3%2E0+software/RCP165%3A+single+exon+control+(Plasmid+%23120110)/pm37000626-255-35-39
Average 91 stars, based on 1 article reviews
pll3 7m clover geminin 1 110 ires mko2 cdt 30 120 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

Image Search Results


Key Resources Table

Journal: Cell chemical biology

Article Title: The Advantages of Targeted Protein Degradation over Inhibition: a RTK Case Study

doi: 10.1016/j.chembiol.2017.09.009

Figure Lengend Snippet: Key Resources Table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies EGFR SantaCruz 1005 FLAG Sigma F1804 Tubulin Sigma T9026 HER2 Cell Signaling 2165S p-EGFR (Y1068) Abcam ab40815 p-HER2 (Y1221/1222) Cell Signaling 2243S p-AKT (T308) Cell Signaling 2965S p-ERK 1/2 (T202/204) Cell Signaling 4370 HER3 Cell Signaling 12708 pHER3 (Y1197) Cell Signaling 4561 pHER3 (Y1289) Cell Signaling 4791 pGSK-3b (S9) Cell Signaling 9331 c-Met Cell Signaling 8198 c-Met Cell Signaling 3127 p-Met (Y1245/1235) Cell Signaling 3126 p-AKT (S473) Cell Signaling 4060 Ubiquitin (P4D1) Cell Signaling 3936 p230 Trans Golgi BD Biosciences 611281 EEA1 BD Biosciences 610456 Clathrin Heavy Chain SantaCruz sc-12734 Alexa Fluor-546 conjugated anti-mouse ThermoFisher A-21143 Alexa Fluor-488 conjugated anti-rabbit ThermoFisher A-11008 HRP linked Mouse IgG GE Life Sciences NA931 HRP Linked Rabbit IgG GE Life Sciences NA934 Chemicals, Peptides, and Recombinant Proteins Cycloheximide Sigma C104450 MLN4924 Sigma 5.05477 PR-619 LifeSensors SI9619 EZ-link Sulfo-NHS-SS-Biotin Thermo 21331 Pierce NeutrAvidin Agarose beads Thermo 29200 Agarose-TUBE 1 LifeSensors UM401 Protein A-Sepharose 4B, Fast Flow beads Sigma P9424 Recombinant Human HGF Protein R&D Systems 294-HG-250 Critical Commercial Assays CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay (MTS) Promega G5421 Experimental Models: Cell Lines OVCAR8 Joyce Liu, Dana Farber MDA-MB-231 ATCC HTB-26 HeLa ATCC CCL-2 HCC827 ATCC CRL-2868 H3255 Katerina Politi, Yale H1975 ATCC CRL-5908 SKBr3 ATCC HTB-30 GTL16 F. Maina, Developmental Biology Institute of Marseille-Luminy Hs746T ATCC HTB-135 Oligonucleotides Clathrin Heavy Chain siRNA SantaCruz sc-35067 Software and Algorithms Image Lab 6.0 Biorad N/A Graphpad Prism N/A Open in a separate window Key Resources Table

Techniques: Ubiquitin Proteomics, Recombinant, Proliferation Assay, Software